Skip to main content

pET His6 GFP TEV LIC cloning vector (1GFP)
(Plasmid #29663)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 29663 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pET
  • Backbone size (bp) 6075
  • Modifications to backbone
    The GFP is the version described in Pedelacq et. al. (Jan 2006, Nature Biotechnology). The following mutations are included: F100S, M154T, V164A, S30R, Y39N, N105T, Y145F, I171V and A206K. These mutations have been shown to enhance brightness and solubility, and to inhibit dimerization.
  • Vector type
    Bacterial Expression
  • Tags / Fusion Proteins
    • 6xHis (N terminal on backbone)
    • GFP (N terminal on backbone)
    • TEV cleavage site (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site LIC tag (destroyed during cloning)
  • 3′ cloning site LIC tag (destroyed during cloning)
  • 5′ sequencing primer GFP forward (5'cagctcgccgaccacta)
  • 3′ sequencing primer T7 reverse
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is an empty vector to be used with a LIC cloning protocol.

It has a TEV-cleavable His6 fusion tag on its N-terminus. GFP can enhance your protein's expression and solubility. It can also be used as a reporter gene.

To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.

Forward - 5'TACTTCCAATCCAATGCA3'

Reverse - 5'TTATCCACTTCCAATGTTATTA3'

Linearize the plasmid with SspI and gel purify.

When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.

More information on this vector can be found through http://qb3.berkeley.edu/macrolab/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET His6 GFP TEV LIC cloning vector (1GFP) was a gift from Scott Gradia (Addgene plasmid # 29663 ; http://n2t.net/addgene:29663 ; RRID:Addgene_29663)