Skip to main content

pET His6 Sumo TEV LIC cloning vector (1S)
(Plasmid #29659)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 29659 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Cloning Grade DNA 29659-DNA.cg 2 µg of cloning grade DNA in Tris buffer 1 $115

Backbone

  • Vector backbone
    pET
  • Backbone size (bp) 5661
  • Vector type
    Bacterial Expression
  • Tags / Fusion Proteins
    • 6xHis (N terminal on backbone)
    • SUMO (N terminal on backbone)
    • TEV cleavage site (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site LIC tag (destroyed during cloning)
  • 3′ cloning site LIC tag (destroyed during cloning)
  • 5′ sequencing primer Sumo forward (5'ttattgaggctcacagagaac)
  • 3′ sequencing primer T7 reverse
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is an empty vector to be used with a LIC cloning protocol.

It has a TEV-cleavable His6 fusion tag on its N-terminus. Sumo can enhance the expression and solubility of your protein of interest.

To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.

Forward - 5'TACTTCCAATCCAATGCA3'

Reverse - 5'TTATCCACTTCCAATGTTATTA3'

Linearize the plasmid with SspI and gel purify.

When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.

More information on this vector can be found through http://qb3.berkeley.edu/macrolab/

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

  • Amount 2 µg
  • Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
  • Pricing $115 USD
  • Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET His6 Sumo TEV LIC cloning vector (1S) was a gift from Scott Gradia (Addgene plasmid # 29659 ; http://n2t.net/addgene:29659 ; RRID:Addgene_29659)