Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pET mCherry LIC cloning vector (u-mCherry)
(Plasmid #29769)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 29769 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    None
  • Tag / Fusion Protein
    • mCherry (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site LIC site vuGFP (destroyed during cloning)
  • 3′ cloning site LIC site vuGFP (destroyed during cloning)
  • 5′ sequencing primer T7 forward
  • 3′ sequencing primer mCherry reverse (5'gcaccttgaagcgcatgaact)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. This plasmid can be used as a single-expression vector, and it is also compatible with our 2-series polycistronic destination vectors (2D, 2E, and 2Z), if co-expression with other genes is desired.

mCherry has a excitation max of 587 nm and an emission max of 610 nm.

To clone into this vector, add LIC tags to the 5' end of your PCR primers.

Forward - 5' TTTAAGAAGGAGATATAGATC3'

Reverse - 5' GTTGGAGGATGAGAGGATCCC 3'

Do NOT include a stop codon with your reverse primer.

Linearize the plasmid with EcoRV, then gel purify.

When digesting the DNA with T4 polymerase, use dGTP for the insert and dCTP for your linearized vector.

More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET mCherry LIC cloning vector (u-mCherry) was a gift from Scott Gradia (Addgene plasmid # 29769 ; http://n2t.net/addgene:29769 ; RRID:Addgene_29769)