-
Purpose(Empty Backbone)
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Berkeley
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 29773 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET
- Backbone size (bp) 5481
-
Vector typeBacterial Expression
-
Tag
/ Fusion Protein
- mCerulean (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. This plasmid can be used as a single-expression vector, and it is also compatible with our 2-series polycistronic destination vectors (2D, 2E, and 2Z), if co-expression with other genes is desired.
mCerulean has a excitation max of 435 nm and an emission max of 477 nm.
To clone into this vector, add LIC tags to the 5' end of your PCR primers.
Forward - 5' TTTAAGAAGGAGATATAGATC3'
Reverse - 5' GTTGGAGGATGAGAGGATCCC 3'
Do NOT include a stop codon with your reverse primer.
Linearize the plasmid with EcoRV, then gel purify.
When digesting the DNA with T4 polymerase, use dGTP for the insert and dCTP for your linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET mCerulean LIC cloning vector (u-mCerulean) was a gift from Scott Gradia (Addgene plasmid # 29773 ; http://n2t.net/addgene:29773 ; RRID:Addgene_29773)