pET29b-RupA_C2-A2-T2-R-CHis
(Plasmid #109256)

• Purpose: NRPS module containing CATR domains with C-terminal 6His tag
• Depositing Lab: Emily Balskus
• Publication: Schneider et al Tetrahedron

Backbone

• Vector backbone: pET29b
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5370
• Total vector size (bp): 9558
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RupA_C2-A2-T2-R
• Species: Ruminococcus bromii
• Insert Size (bp): 4263
• Mutation: contains aa 1023..2443 of WP_015523502.1
• GenBank ID: NC_021013.1 WP_015523502.1
• Promoter: T7
• Tags / Fusion Proteins:
  • His tag (C terminal on backbone)
  • S-Tag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry