LZF40: LZF40_Fsyn_Cre
(Plasmid #109378)

• Purpose: Synaptic transmission
• Depositing Lab: Adam Cohen
• Publication: Adam et al Nature. 2019 May 1. pii: 10.1038/s41586-019-1166-7. doi: 10.1038/s41586-019-1166-7.

Backbone

• Vector backbone: fsyn
• Backbone size w/o insert (bp): 8000
• Total vector size (bp): 9000
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Zeo marker is outside the LTRs and will not be packaged into virus

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Cre-NCBI
• Species: Synthetic
• Insert Size (bp): 1029
• Promoter: human synapsin I

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cgtatgagtgcaagtgggttt
• 3′ sequencing primer: atttgtgaaagattgactggtattctt

Resource Information

• A portion of this plasmid was derived from a plasmid made by: NCBI

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry