Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

ins:MCS; cryaa:RFP
(Plasmid #110282)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 110282 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pKS-insulin_cryaa:RFP
  • Backbone size (bp) 6582
  • Modifications to backbone
    A multiple cloning site (MCS) inserted downstream of the zebrafish insulin promoter.
  • Vector type
    Zebrafish
  • Promoter insulin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer ACACCCTGGTCATCATCCTG
  • 3′ sequencing primer GCTTTATTTGTAACCATTATAAGCTGCA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ins:MCS; cryaa:RFP was a gift from Nikolay Ninov (Addgene plasmid # 110282 ; http://n2t.net/addgene:110282 ; RRID:Addgene_110282)
  • For your References section:

    Different developmental histories of beta-cells generate functional and proliferative heterogeneity during islet growth. Singh SP, Janjuha S, Hartmann T, Kayisoglu O, Konantz J, Birke S, Murawala P, Alfar EA, Murata K, Eugster A, Tsuji N, Morrissey ER, Brand M, Ninov N. Nat Commun. 2017 Sep 22;8(1):664. doi: 10.1038/s41467-017-00461-3. 10.1038/s41467-017-00461-3 [pii] PubMed 28939870