pX330.puro sgRNA KGA Stop1
(Plasmid #110405)

• Purpose: CRISPR/Cas9 vector with sgRNA for glutaminase KGA isoform C-Terminal Knock-in and puromycin resistance
• Depositing Lab: Sandra Martha Gomes Dias
• Publication: HuR (ELAVL1) silencing sensitizes triple-negative breast cancer to glutaminase-targeted therapy (unpublished)

Backbone

• Vector backbone: pX330.puro
• Backbone manufacturer: #110403
• Backbone size w/o insert (bp): 9906
• Total vector size (bp): 9909
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GLS glutaminase
• gRNA/shRNA sequence: ATCTTGATGGATTGTTGTAA
• Species: H. sapiens (human)
• Entrez Gene: GLS (a.k.a. AAD20, CASGID, DEE71, EIEE71, GAC, GAM, GDPAG, GLS1, KGA)
• Promoter: CBh

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: agggatggttggttggtggg
• 3′ sequencing primer: CCAATCCTCCCCCTTGCTGT

Resource Information

• Supplemental Documents:
  • pD089-pX330.puro sgRNA KGA Stop1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

sgRNA for GLS exon 19 (KGA isoform stop codon), intended to perform C-Terminal knock-in using pX330 with puromycin resistance.

System options:
sgRNA:
pX330.puro sgRNA KGA Stop1 (Addgene #110405)

Homology arms:
pUC19 KGA HA5'-mKO2-3' (Addgene #110406)
pUC19 KGA HA5'-mKO2-P2A-3' (Addgene #110407)
pUC19 KGA HA5'-mKO2-P2A-Zeo-3' (Addgene #110408)