-
Depositing Lab
-
Depositing OrganizationDana-Farber Cancer Institute
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 11048 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 11048-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 11048-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5400
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHRPT2
-
Alt nameCDC73
-
Alt nameparafibromin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1596
-
Entrez GeneCDC73 (a.k.a. C1orf28, FIHP, HPTJT, HRPT1, HRPT2, HYX)
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer SP6
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Author has deposited insert sequence. Click on "sequence" to view. Cloned using the following primers 5' CGGAATTCGGATCCACCATGGATTACAAGGATGACGACGATAAGGTCGACATGGCGGACGTGCTTAGCGT 3' and 5' CCGCTCGAGTCAGAATCTCAAGTGCGATTTATGCTT 3'
DNA (Catalog # 11048-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 11048-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3 HRPT2 was a gift from Matthew Meyerson (Addgene plasmid # 11048 ; http://n2t.net/addgene:11048 ; RRID:Addgene_11048) -
For your References section:
The parafibromin tumor suppressor protein is part of a human Paf1 complex. Rozenblatt-Rosen O, Hughes CM, Nannepaga SJ, Shanmugam KS, Copeland TD, Guszczynski T, Resau JH, Meyerson M. Mol Cell Biol. 2005 Jan . 25(2):612-20. 10.1128/MCB.25.2.612-620.2005 PubMed 15632063