Skip to main content

Human USP30 (1-517, WT, MG-38-11)
(Plasmid #110748)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110748 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 110748-D50 50 μg of DNA in Tris buffer $495
DNA 110748-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pTriEx2
  • Backbone manufacturer
    Merck
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    USP30
  • Species
    H. sapiens (human)
  • Entrez Gene
    USP30
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AATACGACTCACTATAGGG
  • 3′ sequencing primer TCGATCTCAGTGGTATTTGTG
  • (Common Sequencing Primers)

Resource Information

  • Addgene Notes
  • A portion of this plasmid was derived from a plasmid made by
    USP30 gene obtained through gene synthesis

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Human USP30 (1-517, WT, MG-38-11) was a gift from David Komander (Addgene plasmid # 110748 ; http://n2t.net/addgene:110748 ; RRID:Addgene_110748)
  • For your References section:

    Mechanism and regulation of the Lys6-selective deubiquitinase USP30. Gersch M, Gladkova C, Schubert AF, Michel MA, Maslen S, Komander D. Nat Struct Mol Biol. 2017 Sep 25. doi: 10.1038/nsmb.3475. 10.1038/nsmb.3475 PubMed 28945249