Human USP30 (1-517, C77A, MG-38-16)
(Plasmid
#110749)
-
PurposeTransient transfection of human USP30 C77A
-
Depositing Lab
-
Depositing OrganizationMRC Laboratory of Molecular Biology
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110749 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 110749-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 110749-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepTriEx2
-
Backbone manufacturerMerck
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameUSP30
-
SpeciesH. sapiens (human)
-
MutationC77A
-
Entrez GeneUSP30
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AATACGACTCACTATAGGG
- 3′ sequencing primer TCGATCTCAGTGGTATTTGTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byUSP30 gene obtained through gene synthesis
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 110749-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 110749-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Human USP30 (1-517, C77A, MG-38-16) was a gift from David Komander (Addgene plasmid # 110749 ; http://n2t.net/addgene:110749 ; RRID:Addgene_110749) -
For your References section:
Mechanism and regulation of the Lys6-selective deubiquitinase USP30. Gersch M, Gladkova C, Schubert AF, Michel MA, Maslen S, Komander D. Nat Struct Mol Biol. 2017 Sep 25. doi: 10.1038/nsmb.3475. 10.1038/nsmb.3475 PubMed 28945249