Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Human USP30 (1-517, WT, MG-38-11)
(Plasmid #110748)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 110748 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTriEx2
  • Backbone manufacturer
    Merck
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    USP30
  • Species
    H. sapiens (human)
  • Entrez Gene
    USP30
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AATACGACTCACTATAGGG
  • 3′ sequencing primer TCGATCTCAGTGGTATTTGTG
  • (Common Sequencing Primers)

Resource Information

  • Addgene Notes
  • A portion of this plasmid was derived from a plasmid made by
    USP30 gene obtained through gene synthesis

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Human USP30 (1-517, WT, MG-38-11) was a gift from David Komander (Addgene plasmid # 110748 ; http://n2t.net/addgene:110748 ; RRID:Addgene_110748)
  • For your References section:

    Mechanism and regulation of the Lys6-selective deubiquitinase USP30. Gersch M, Gladkova C, Schubert AF, Michel MA, Maslen S, Komander D. Nat Struct Mol Biol. 2017 Sep 25. doi: 10.1038/nsmb.3475. 10.1038/nsmb.3475 PubMed 28945249