-
PurposePiggyBac compatible plasmid expressing dCas9
-
Depositing Labs
-
Depositing OrganizationHarvard University
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110823 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 110823-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 110823-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepB-CAGGS
- Total vector size (bp) 11700
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9
-
Alt namedCas9
-
SpeciesSynthetic
-
Insert Size (bp)4150
-
MutationCas9 mutations to make dCas9=D10A+D839A+H840A+N863A
- Promoter CAGGS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGTACTTCGACACCACCA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 110823-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 110823-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pB-CAGGS-dCas9 was a gift from Alejandro Chavez & George Church (Addgene plasmid # 110823 ; http://n2t.net/addgene:110823 ; RRID:Addgene_110823) -
For your References section:
An enhanced CRISPR repressor for targeted mammalian gene regulation. Yeo NC, Chavez A, Lance-Byrne A, Chan Y, Menn D, Milanova D, Kuo CC, Guo X, Sharma S, Tung A, Cecchi RJ, Tuttle M, Pradhan S, Lim ET, Davidsohn N, Ebrahimkhani MR, Collins JJ, Lewis NE, Kiani S, Church GM. Nat Methods. 2018 Jul 16. pii: 10.1038/s41592-018-0048-5. doi: 10.1038/s41592-018-0048-5. 10.1038/s41592-018-0048-5 PubMed 30013045