pV1010
(Plasmid
#111423)
-
PurposegRNA plasmid for cleavage of Candida albicans ADE2 - integrates at RPS1 (Part of Duet system)
-
Depositing Lab
-
Depositing OrganizationWhitehead Institute for Biomedical Research
Located in the United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111423 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepV951
-
Backbone manufacturerValmik Vyas
-
Vector typeYeast Expression, CRISPR
-
Selectable markersclonNAT
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgADE-NT2
-
gRNA/shRNA sequencecaacaatcatacgacctaat
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pV1010 was a gift from Gerald Fink (Addgene plasmid # 111423 ; http://n2t.net/addgene:111423 ; RRID:Addgene_111423) -
For your References section:
A CRISPR system permits genetic engineering of essential genes and gene families. Vyas VK, Barrasa MI, Fink GR. Sci Adv. 2015;1(3):e1500248. 10.1126/sciadv.1500248 PubMed 25977940