Skip to main content

pCRISPR_eGFP_191
(Plasmid #111821)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111821 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 111821-D50 50 μg of DNA in Tris buffer $495
DNA 111821-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    All_in_one_CRISPR/Cas9_LacZ
  • Backbone manufacturer
    Lynne Postovit (Addgene plasmid # 74293)
  • Backbone size w/o insert (bp) 10694
  • Total vector size (bp) 10394
  • Modifications to backbone
    Removal of LacZ-alpha in the cloning process
  • Vector type
    Mammalian Expression, Bacterial Expression, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA targeting eGFP 171-191
  • gRNA/shRNA sequence
    ACTGCACGCCGTAGGTCAGGG
  • Species
    H. sapiens (human), Synthetic
  • Promoter U6
  • Tag / Fusion Protein
    • mCherry

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer SP6 Forward: ATTTAGGTGACACTATAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPR_eGFP_191 was a gift from Steve Shih (Addgene plasmid # 111821 ; http://n2t.net/addgene:111821 ; RRID:Addgene_111821)
  • For your References section:

    An automated microfluidic gene-editing platform for deciphering cancer genes. Sinha H, Quach ABV, Vo PQN, Shih SCC. Lab Chip. 2018 Jul 24;18(15):2300-2312. doi: 10.1039/c8lc00470f. 10.1039/c8lc00470f PubMed 29989627