Skip to main content

pONSY-Venus
(Plasmid #111875)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111875 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 111875-D50 50 μg of DNA in Tris buffer $495
DNA 111875-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pONSY
  • Backbone size w/o insert (bp) 5127
  • Modifications to backbone
    Capsaspora expression vector (backbone) modified from the pCR2.1 vector. It bears the promoter and terminator regions from the endogenous Elongation Factor 1 alpha (EF1a) gene (CAOG_07807) cloned using Restriction Enzymes and Gibson Assembly strategies.
  • Vector type
    Capsaspora owczarzaki

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Venus
  • Insert Size (bp)
    720
  • Promoter Elongation Factor 1 alpha (EF1a) from Capsaspora
  • Tag / Fusion Protein
    • Venus (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (unknown if destroyed)
  • 3′ cloning site none (unknown if destroyed)
  • 5′ sequencing primer CTGGTACCAAATGCACAGTTAGCAACGACC
  • 3′ sequencing primer CATTGCTAGTGCTGTTCTCACC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pONSY-Venus was a gift from Inaki Ruiz-Trillo (Addgene plasmid # 111875 ; http://n2t.net/addgene:111875 ; RRID:Addgene_111875)
  • For your References section:

    Transfection of Capsaspora owczarzaki, a close unicellular relative of animals. Parra-Acero H, Ros-Rocher N, Perez-Posada A, Kozyczkowska A, Sanchez-Pons N, Nakata A, Suga H, Najle SR, Ruiz-Trillo I. Development. 2018 May 11. pii: dev.162107. doi: 10.1242/dev.162107. 10.1242/dev.162107 PubMed 29752387