pONSY-Lifeact:mCherry
(Plasmid
#111876)
-
PurposeThis plasmid expresses mCherry fused to Lifeact peptide. It labels actin bundles and filopodia in Capsaspora. Codons have been optimised according to their usages in Capsaspora and C. fragrantissima.
-
Depositing Lab
-
Depositing OrganizationAgencia Estatal Consejo Superior de Investigaciones Científicas, M.P.
Located in Spain -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111876 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 111876-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 111876-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepONSY
- Backbone size w/o insert (bp) 5127
-
Modifications to backboneCapsaspora expression vector (backbone) modified from the pCR2.1 vector. It bears the promoter and terminator regions from the endogenous Elongation Factor 1 alpha (EF1a) gene (CAOG_07807) cloned using Restriction Enzymes and Gibson Assembly strategies.
-
Vector typeCapsaspora owczarzaki
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLifeact fused to mCherry
-
Insert Size (bp)780
- Promoter Elongation Factor 1 alpha (EF1a) from Capsaspora
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XmaI (not destroyed)
- 3′ cloning site XbaI (destroyed during cloning)
- 5′ sequencing primer CCCGGGACCATGGGTGTGGCAGACCTGATTAAGAAGTTCGAGAGCATT
- 3′ sequencing primer TCTAGATGGTGGGTCACCCTCCTCCTTGCTAATGCTCTCGAACTTCTT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 111876-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 111876-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pONSY-Lifeact:mCherry was a gift from Inaki Ruiz-Trillo (Addgene plasmid # 111876 ; http://n2t.net/addgene:111876 ; RRID:Addgene_111876) -
For your References section:
Transfection of Capsaspora owczarzaki, a close unicellular relative of animals. Parra-Acero H, Ros-Rocher N, Perez-Posada A, Kozyczkowska A, Sanchez-Pons N, Nakata A, Suga H, Najle SR, Ruiz-Trillo I. Development. 2018 May 11. pii: dev.162107. doi: 10.1242/dev.162107. 10.1242/dev.162107 PubMed 29752387