Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pONSY-CoH2B:Venus
(Plasmid #111877)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 111877 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pONSY
  • Backbone size w/o insert (bp) 5127
  • Modifications to backbone
    Capsaspora expression vector (backbone) modified from the pCR2.1 vector. It bears the promoter and terminator regions from the endogenous Elongation Factor 1 alpha (EF1a) gene (CAOG_07807) cloned using Restriction Enzymes and Gibson Assembly strategies.
  • Vector type
    Capsaspora owczarzaki

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Capsaspora Histone H2B (CoH2B) fused to Venus
  • Species
    Capsaspora owczarzaki
  • Insert Size (bp)
    1113
  • GenBank ID
    CAOG_01818
  • Promoter Elongation Factor 1 alpha (EF1a) from Capsaspora
  • Tag / Fusion Protein
    • Venus (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SmaI (not destroyed)
  • 3′ cloning site SpeI (destroyed during cloning)
  • 5′ sequencing primer TACCCGGGATGCCGCCGAAGGTC
  • 3′ sequencing primer TAACTAGTCTTGGCGCCGGAGGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pONSY-CoH2B:Venus was a gift from Inaki Ruiz-Trillo (Addgene plasmid # 111877 ; http://n2t.net/addgene:111877 ; RRID:Addgene_111877)
  • For your References section:

    Transfection of Capsaspora owczarzaki, a close unicellular relative of animals. Parra-Acero H, Ros-Rocher N, Perez-Posada A, Kozyczkowska A, Sanchez-Pons N, Nakata A, Suga H, Najle SR, Ruiz-Trillo I. Development. 2018 May 11. pii: dev.162107. doi: 10.1242/dev.162107. 10.1242/dev.162107 PubMed 29752387