gRNAs[bTub+Sxl].1046B
(Plasmid
#112692)
-
Purposeexpress two gRNA targeting bTub & Sxl under dU6-3 promoter
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Diego (UCSD)
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112692 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 112692-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 112692-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonewhite+attB
-
Vector typeCRISPR
-
Selectable markersmini-white
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameU6.3-gRNA[bTub] and U6.3-gRNA[Sxl]
-
gRNA/shRNA sequenceCCTGAGTGTGCATCAGCTGG and GATTGTCAACTACTTGCCCC
-
SpeciesD. melanogaster (fly)
-
Entrez GeneSxl (a.k.a. Dmel_CG43770, CG14425, CG18350, CG33070, CG43770, Dm-Sxl, DmSxl, Dmel\CG43770, Dmel_CG14425, Dmel_CG18350, Fl, Mex156, ORF2, SXL, Su(da), Sx1, SxL, Sxl-1 Sxl-2, Sxl-Pe, SxlPe, SxlPm, dSXL, fs(1)K1274, fs(1)M106, l(1)6Fa, melSxl, sxl)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 112692-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 112692-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
gRNAs[bTub+Sxl].1046B was a gift from Omar Akbari (Addgene plasmid # 112692 ; http://n2t.net/addgene:112692 ; RRID:Addgene_112692) -
For your References section:
Transforming insect population control with precision guided sterile males with demonstration in flies. Kandul NP, Liu J, Sanchez C HM, Wu SL, Marshall JM, Akbari OS. Nat Commun. 2019 Jan 8;10(1):84. doi: 10.1038/s41467-018-07964-7. 10.1038/s41467-018-07964-7 PubMed 30622266