Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCD061
(Plasmid #113315)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 113315 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    W108 scRNA.b1_MS2
  • gRNA/shRNA sequence
    GAAGATCCGGCCTGCAGCCA
  • Species
    Synthetic

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aataggcgtatcacgaggcag
  • 3′ sequencing primer GTTTCGCCACCTCTGACTTG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCD061 was a gift from Jesse Zalatan (Addgene plasmid # 113315 ; http://n2t.net/addgene:113315 ; RRID:Addgene_113315)
  • For your References section:

    Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria. Dong C, Fontana J, Patel A, Carothers JM, Zalatan JG. Nat Commun. 2018 Jun 27;9(1):2489. doi: 10.1038/s41467-018-04901-6. 10.1038/s41467-018-04901-6 PubMed 29950558