PB-iRFP-STOP-ReNL
(Plasmid #113965)

• Purpose: Piggybac transposon plasmid CRISPR gene deletion activatable fluorescence. Constitutive iRFP670 under EF1A promoter, CMV promoter with two SV40 polyA followed by red-enhanced nanolantern (ReNL)
• Depositing Lab: Jordan Green
• Publication: Rui et al Sci Adv. 2019 Dec 6;5(12):eaay3255. doi: 10.1126/sciadv.aay3255. eCollection 2019 Dec.

Backbone

• Vector backbone: pBR322
• Modifications to backbone: Piggybac inserts
• Vector type: Mammalian Expression ; Piggybac transposon

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: iRFP670
• Species: H. sapiens (human), M. musculus (mouse), Synthetic
• Insert Size (bp): 950
• GenBank ID: KC991142
• Promoter: EF1A

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCTTCCTTGACCCTGGAAGG
• 3′ sequencing primer: ATTAAGGGATCTGTAGGGCG

Gene/Insert 2

• Gene/Insert name: ReNL
• Alt name: Red enhanced nanolantern
• Species: H. sapiens (human), M. musculus (mouse), Synthetic
• Insert Size (bp): 1908
• GenBank ID: LC128718
• Promoter: CMV - SV40-PolyA - SV40-PolyA

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: AATTCATGGTGAGCAAGGGC
• 3′ sequencing primer: CCTGTGTGAAATTGTTATCCGCT

Resource Information

• Supplemental Documents:
  • PB-iRFP-STOP-ReNL
• A portion of this plasmid was derived from a plasmid made by: pNLS-iRFP670 was a gift from Vladislav Verkhusha (Addgene plasmid # 45466) ReNL/pcDNA3 was a gift from Takeharu Nagai (Addgene plasmid # 85203)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Piggybac transposon plasmid for stable expression of iRFP670 (far red fluorescent protein) for FACS sorting with CRISPR/Cas9 mediated fluorescence/luminescence reporter of ReNL following elimination of SV40 polyA sequences by gene editing deletion.