pSKB3.TM1777
(Plasmid #11421)

• Depositing Lab: Sung-Hou Kim
• Publication: Shin et al Biochemistry. 2003 Nov 25. 42(46):13429-37.

Backbone

• Vector backbone: pSKB3
• Backbone size w/o insert (bp): 5386
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NusA
• Species: T. maritima
• Insert Size (bp): 1032
• GenBank ID: AAD36840 NP_229574 TM1777
• Entrez Gene: nusA
• Tags / Fusion Proteins:
  • 6x His (N terminal on backbone)
  • TEV protease site (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the plasmid pSKB3.TM1777 contains a Kanamycin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.

Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244