pSKB3.MPN348
(Plasmid #11437)

• Depositing Lab: Sung-Hou Kim
• Publication: Chen et al Proteins. 2004 Sep 1. 56(4):839-43.

Backbone

• Vector backbone: pSKB3
• Backbone size w/o insert (bp): 5386
• Modifications to backbone: derivative of bacterial expression vector pET-28a with the thrombin protease site replaced by a TEV protease site
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: methenyltetrahydrofolate synthetase
• Species: Mycoplasma pneumoniae M129
• Insert Size (bp): 492
• GenBank ID: AAB96136 MPN348 NP_110036
• Tags / Fusion Proteins:
  • 6x His (N terminal on backbone)
  • TEV cleavage site (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the plasmid pSKB3.MPN348 contains a Kanamycin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.

Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244