Skip to main content

Ai170 (TIT2L-ASAP2s-Kv-ICL-tTA2) targeting vector
(Plasmid #114435)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 114435 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 114435-D50 50 μg of DNA in Tris buffer $495
DNA 114435-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    TIGRE2.0 targeting vector
  • Backbone size w/o insert (bp) 15809
  • Total vector size (bp) 17326
  • Vector type
    Mouse Targeting, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ASAP2s-Kv, tTA2
  • Alt name
    ASAP2s
  • Insert Size (bp)
    1517
  • Promoter TRE2, CAG
  • Tag / Fusion Protein
    • Kv2.1 tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Mlul... (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer CTAATTCCATCAGAAAGCTT
  • 3′ sequencing primer CTGCCCGGCGGCTGTGAGCG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Michael Lin and Clontech

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Ai170 (TIT2L-ASAP2s-Kv-ICL-tTA2) targeting vector was a gift from Michael Lin & Hongkui Zeng (Addgene plasmid # 114435 ; http://n2t.net/addgene:114435 ; RRID:Addgene_114435)
  • For your References section:

    A Suite of Transgenic Driver and Reporter Mouse Lines with Enhanced Brain-Cell-Type Targeting and Functionality. Daigle TL, Madisen L, Hage TA, Valley MT, Knoblich U, Larsen RS, Takeno MM, Huang L, Gu H, Larsen R, Mills M, Bosma-Moody A, Siverts LA, Walker M, Graybuck LT, Yao Z, Fong O, Nguyen TN, Garren E, Lenz GH, Chavarha M, Pendergraft J, Harrington J, Hirokawa KE, Harris JA, Nicovich PR, McGraw MJ, Ollerenshaw DR, Smith KA, Baker CA, Ting JT, Sunkin SM, Lecoq J, Lin MZ, Boyden ES, Murphy GJ, da Costa NM, Waters J, Li L, Tasic B, Zeng H. Cell. 2018 Jul 12;174(2):465-480.e22. doi: 10.1016/j.cell.2018.06.035. 10.1016/j.cell.2018.06.035 PubMed 30007418