negEKARet-cyto
(Plasmid
#114734)
-
PurposeNegative control of EKARet-cyto
-
Depositing Lab
-
Depositing OrganizationMax Planck Florida Institute
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 114734 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 114734-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 114734-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCI
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNegative Control of EKARet-cyto
-
Insert Size (bp)2000
- Promoter CMV
-
Tags
/ Fusion Proteins
- sREAChet (N terminal on insert)
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer CMV Forward
- 3′ sequencing primer CCCTGAACCTGAAACATAAAATG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Our lab (EKAR), Michiyuki Matsuda (EKAREV)
DNA (Catalog # 114734-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 114734-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
negEKARet-cyto was a gift from Ryohei Yasuda (Addgene plasmid # 114734 ; http://n2t.net/addgene:114734 ; RRID:Addgene_114734) -
For your References section:
Imaging ERK and PKA Activation in Single Dendritic Spines during Structural Plasticity. Tang S, Yasuda R. Neuron. 2017 Mar 22;93(6):1315-1324.e3. doi: 10.1016/j.neuron.2017.02.032. Epub 2017 Mar 9. 10.1016/j.neuron.2017.02.032 PubMed 28285819