Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AKARet-cyto
(Plasmid #96897)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 96897 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FLIM Sensor for PKA Activity in Cytosol
  • Alt name
    AKARet-cyto
  • Insert Size (bp)
    2300
  • Promoter CMV
  • Tags / Fusion Proteins
    • sREAChet (N terminal on insert)
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer CMV Forward
  • 3′ sequencing primer CCCTGAACCTGAAACATAAAATG
  • (Common Sequencing Primers)

Resource Information

  • Addgene Notes
  • A portion of this plasmid was derived from a plasmid made by
    Our lab (EKAR), Michiyuki Matsuda (AKAR3EV)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Harvey, C.D., Ehrhardt, A.G., Cellurale, C., Zhong, H., Yasuda, R., Davis, R.J., and Svoboda, K. (2008). A genetically encoded fluorescent sensor of ERK activity. Proc. Natl. Acad. Sci. USA 105, 19264–19269.

Komatsu, N., Aoki, K., Yamada, M., Yukinaga, H., Fujita, Y., Kamioka, Y., and Matsuda, M. (2011). Development of an optimized backbone of FRET biosensors for kinases and GTPases. Mol. Biol. Cell 22, 4647–4656.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AKARet-cyto was a gift from Ryohei Yasuda (Addgene plasmid # 96897 ; http://n2t.net/addgene:96897 ; RRID:Addgene_96897)
  • For your References section:

    Imaging ERK and PKA Activation in Single Dendritic Spines during Structural Plasticity. Tang S, Yasuda R. Neuron. 2017 Mar 22;93(6):1315-1324.e3. doi: 10.1016/j.neuron.2017.02.032. Epub 2017 Mar 9. 10.1016/j.neuron.2017.02.032 PubMed 28285819