Skip to main content

p CIneo-RL-Let7-3xBulgeB
(Plasmid #115368)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 115368 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 115368-D50 50 μg of DNA in Tris buffer $495
DNA 115368-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCIneo
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5472
  • Vector type
    Mammalian Expression, Luciferase
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Renilla Luciferase
  • Alt name
    Let7 3x bulge bind site: GGACAGCCTATTGAACTACCTCACTCGGAGCACA GCCTATTGAACTACCTCAGGCCTGCACAGCCTATTGAACTACCTCA
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba1 (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer T3
  • 3′ sequencing primer T7
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

clone number 142

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p CIneo-RL-Let7-3xBulgeB was a gift from Witold Filipowicz & Ramesh Pillai (Addgene plasmid # 115368 ; http://n2t.net/addgene:115368 ; RRID:Addgene_115368)
  • For your References section:

    Inhibition of translational initiation by Let-7 MicroRNA in human cells. Pillai RS, Bhattacharyya SN, Artus CG, Zoller T, Cougot N, Basyuk E, Bertrand E, Filipowicz W. Science. 2005 Sep 2. 309(5740):1573-6. 10.1126/science.1115079 PubMed 16081698