pAcUW51-gEgIL
(Plasmid #11622)

• Depositing Lab: Pamela Bjorkman
• Publication: Sprague et al J Biol Chem. 2004 Apr 2. 279(14):14184-93.

Backbone

• Vector backbone: pAcUW51
• Backbone manufacturer: BD Biosciences
• Backbone size w/o insert (bp): 5863
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HSV-1 glycoprotein E and HSV-1 glycoprotein I
• Alt name: HSV-1 gE
• Alt name: HSV-1 gI
• Species: herpes simplex virus type I KOS strain
• Insert Size (bp): 1200
• Mutation: Dicistronic vector containing HSV-1 gE (KOS strain) ecotdomain (aa 21-419) between BglII and EcoRI site under the p10 promoter and HSV-1 gI (KOS strain) ectodomain (aa 21-265 with deletion of aa 221-227) in BamHI site under the ppolh promoter. gI contains a FactorXa-cleavable C-terminal His6 tag. gI insert sequenced with 5' primer CCGGATCTGATCATGGAGATAA 3' primer TCGCTCTAACATACCACCCT
• Tag / Fusion Protein:
  • His (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGGACCTTTAATTCAACCCAAC
• 3′ sequencing primer: TTGACACCAGACCAACTGGT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry