Skip to main content

pXPR_BRD003 Luciferase
(Plasmid #117072)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117072 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 117072-D50 50 μg of DNA in Tris buffer $495
DNA 117072-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pXPR_BRD003
  • Backbone manufacturer
    Broad Institute
  • Backbone size w/o insert (bp) 8318
  • Total vector size (bp) 8318
  • Vector type
    CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Luciferase
  • gRNA/shRNA sequence
    AATTGTCTTGTCCCTATCGA
  • Species
    E. coli
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXPR_BRD003 Luciferase was a gift from William Hahn (Addgene plasmid # 117072 ; http://n2t.net/addgene:117072 ; RRID:Addgene_117072)
  • For your References section:

    Renal medullary carcinomas depend upon SMARCB1 loss and are sensitive to proteasome inhibition. Hong AL, Tseng YY, Wala JA, Kim WJ, Kynnap BD, Doshi MB, Kugener G, Sandoval GJ, Howard TP, Li J, Yang X, Tillgren M, Ghandi M, Sayeed A, Deasy R, Ward A, McSteen B, Labella KM, Keskula P, Tracy A, Connor C, Clinton CM, Church AJ, Crompton BD, Janeway KA, Van Hare B, Sandak D, Gjoerup O, Bandopadhayay P, Clemons PA, Schreiber SL, Root DE, Gokhale PC, Chi SN, Mullen EA, Roberts CW, Kadoch C, Beroukhim R, Ligon KL, Boehm JS, Hahn WC. Elife. 2019 Mar 12;8. pii: 44161. doi: 10.7554/eLife.44161. 10.7554/eLife.44161 PubMed 30860482