-
PurposeFluorescent reporter for AP-1 activation
-
Depositing Lab
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118095 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepSIRV
- Backbone size w/o insert (bp) 4968
- Total vector size (bp) 5679
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
-
SpeciesSynthetic
- Promoter minimal promoter with AP-1 responsive element
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hind III (not destroyed)
- 3′ cloning site Not I (not destroyed)
- 5′ sequencing primer ctgaggcagaaaggaccatcc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSIRV-AP-1-mCherry was a gift from Peter Steinberger (Addgene plasmid # 118095 ; http://n2t.net/addgene:118095 ; RRID:Addgene_118095) -
For your References section:
Assessment of costimulation and coinhibition in a triple parameter T cell reporter line: Simultaneous measurement of NF-kappaB, NFAT and AP-1. Jutz S, Leitner J, Schmetterer K, Doel-Perez I, Majdic O, Grabmeier-Pfistershammer K, Paster W, Huppa JB, Steinberger P. J Immunol Methods. 2016 Jan 15. pii: S0022-1759(16)30007-2. doi: 10.1016/j.jim.2016.01.007. 10.1016/j.jim.2016.01.007 PubMed 26780292