Skip to main content

Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR EGFP-guide3
(Plasmid #118160)

  • Purpose
    CRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA3 against the EGFP CDS
  • Depositing Lab
  • Depositing Organization
    Imperial College London
    Located in the United Kingdom of Great Britain and Northern Ireland
  • Sequence Information

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118160 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR
  • Backbone manufacturer
    Feng Zhang (Addgene #52961)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KRAB-dCas9-2A-BlastR
  • gRNA/shRNA sequence
    GATGCCGTTCTTCTGCTTGT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4907
  • Promoter EF1a core and U6
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (destroyed during cloning)
  • 3′ cloning site Unknown (destroyed during cloning)
  • 5′ sequencing primer GATCCGCCACCATGGATGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: Plasmid contains a N1396S mutation in dCas9. This mutation is not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR EGFP-guide3 was a gift from Jorge Ferrer (Addgene plasmid # 118160 ; http://n2t.net/addgene:118160 ; RRID:Addgene_118160)