pCS2+ AMIC
(Plasmid #118420)

• Purpose: For mammalian expression of Amoeba myosin 1C
• Depositing Lab: Michael Tsang
• Publication: Saydmohammed et al Nat Commun. 2018 Aug 23;9(1):3381. doi: 10.1038/s41467-018-05866-2.

Backbone

• Vector backbone: pCS2+
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Amoeba myosin 1C
• Species: Acanthamoeba castellanii
• Insert Size (bp): 3562
• Mutation: See depositor comments below

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Nco1 (unknown if destroyed)
• 3′ cloning site: Xba1 (unknown if destroyed)
• 5′ sequencing primer: cggtcaacccctacaaacaaatcaac
• 3′ sequencing primer: ttacatgccggggggaggaggacc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note: Plasmid contains a F382I mutation, a G1072-K1073 deletion, and a S1074A mutation in AMIC compared to the NCBI reference sequence AAC98089.1. These differences are not known to affect plasmid function.