pMCh1750_S2F-IMCg_doxy-CMV_mChe-Cdc42E7
(Plasmid #118614)

• Purpose: expression of mChe-tagged cdc42E7 under doxy-inducible CMV promoter
• Depositing Lab: Marina Chekulaeva
• Publication: Ciolli Mattioli et al Nucleic Acids Res. 2018 Dec 22. pii: 5258023. doi: 10.1093/nar/gky1270.

Backbone

• Vector backbone: S2F
• Backbone size w/o insert (bp): 9025
• Total vector size (bp): 11725
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: cdc42E7
• Species: M. musculus (mouse)
• Insert Size (bp): 1983
• GenBank ID: NM_009861 NM_009861
• Entrez Gene: Cdc42
• Promoter: tetON CMV
• Tag / Fusion Protein:
  • mCherry (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: ACTTGTGGCCGTTTACGTCG
• 3′ sequencing primer: gatctcaaatccctcggaagc

Resource Information

• Supplemental Documents:
  • pMCh1750_S2F-IMCg_doxy-CMV_mChe-Cdc42E7

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry