pAC1804_pmax-dCasRx-RBM38
(Plasmid
#118638)
-
PurposeTransient transfection; Expresses dCasRx-RBM38; CAGGS promoter
-
Depositing Lab
-
Depositing OrganizationJackson Laboratory
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118638 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 118638-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 118638-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepMAX
-
Backbone manufacturerAmaxa
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCasRx-RBM38
-
SpeciesSynthetic
- Promoter CAGGS
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gggcttgtcgagacagagaagat
- 3′ sequencing primer ACCGAGGAGAGGGTTAGGGAT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bydCasRx coding sequence from Konermann et al (doi:10.1016/j.cell.2018.02.033) XR002: EF1a-dCasRx-2A-EGFP (Plasmid #109050); Effector sequence cloned using IDT gBlock as template
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
More info at http://CasFx.org . Please visit https://www.biorxiv.org/content/early/2018/09/30/431064 for bioRxiv preprint.
DNA (Catalog # 118638-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 118638-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAC1804_pmax-dCasRx-RBM38 was a gift from Albert Cheng (Addgene plasmid # 118638 ; http://n2t.net/addgene:118638 ; RRID:Addgene_118638) -
For your References section:
CRISPR artificial splicing factors. Du M, Jillette N, Zhu JJ, Li S, Cheng AW. Nat Commun. 2020 Jun 12;11(1):2973. doi: 10.1038/s41467-020-16806-4. 10.1038/s41467-020-16806-4 PubMed 32532987