Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pBS598 EF1alpha-EGFPcre Notes

DNA Sequence of EGFPcre region (by computer-assisted assembly) from Dr Sauer

ctagcgctaccggtcgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctgg
tcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccaccta
cggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgacc
accctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagt
ccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccg
cgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggag
gacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgaca
agcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgc
cgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagc
acccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccg
ccgccgggatcactctcggcatggacgagctgtacaagtccggtacagctctcgacggagaaagctcagg
ctctggctcagagtctgactccatggccaatttactgaccgtacaccaaaatttgcctgcattaccggtc
gatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatcgccaggcgttttctgagc
atacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatg
gtttcccgcagaacctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaa
actatccagcaacatttgggccagctaaacatgcttcatcgtcggtccgggctgccacgaccaagtgaca
gcaatgctgtttcactggttatgcggcggatccgaaaagaaaacgttgatgccggtgaacgtgcaaaaca
ggctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccag
gatatacgtaatctggcatttctggggattgcttataacaccctgttacgtatagccgaaattgccagga
tcagggttaaagatatctcacgtactgacggtgggagaatgttaatccatattggcagaacgaaaacgct
ggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttcc
gtctctggtgtagctgatgatccgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgc
catctgccaccagccagctatcaactcgcgccctggaagggatttttgaagcaactcatcgattgattta
cggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcg
cgagatatggcccgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaata
ttgtcatgaactatatccgtaacctggatagtgaaacaggggcaatggtgcgcctgctggaagatggcga
ttagccattaacgcgtaaatgattgctataattatttgatatttatggtgacatatgagaaaggatttca
acatcgacggaaaatatgtagtactgtctgtaagcactaatattcagtcgccagccgtcattgtcactgt
aaagctgagcgatagaatgcctgatattgactcaatatccgttgcgtttcctgtcaaaagtatgcgtagt
gctgaacatttcgtgatgaatgccaccgaggaagaagcacggcgcggttttgctaaagtgatgtctgagt
ttggcgaactcttgggtaaggttaaaattgtcgagggatctcggaatggaccccaactgctcctgctcca
ccggtaagactcccgatccttggtctttagaataccaagttgggaccgcagagcggaatccccgagttgt
agaggcttggcgggaataggcacctttagttggcgattcattccggttctttctagaatccgctcttgca
aaagccttcattagttacgagtattgtcgaacgggtcctttggcggggttggggctaggatttagacgcg
caaatgtccggttcctgatcacccagttagtggggacatctgggttgagtcccaggcattactaaactta
ctgtgaattgcttgaattaagaaagaggtgaaggacctttatgtcttgggactcaaagacataatccctg
acttaacctgtgaggagaaaagtggggctaggctccctgcagctccgaggaggacttagtgaactgagcc
gggactcgtggtgttggccactgctgtaatgctgcctccctcatgctgtcttctttctcctcccaggcgg
ctcctgcacttgcaccagctcctgcgcctgcaagaactgcaagtgcacctcctgcaagaagagtgagttg
ggacaccttgggtggcggctaaggctaggggcggggaactcctacaaaactggctctgagaaatgtcctt
tgcttcccggaggccattgtattgtctcggggacagaactatacagagaactatttaaaaaaaccgaggt
cttctctgttggggacaggaagcagaggtcttcagccaggctgcctcttcctccttcttctaggctgctg
ctcctgctgtcccgtgggctgctccaaatgtgcccagggctgtgtctgcaaaggcgccgcggacaagtgc
acgtgctgtgcctgatgtgacgaacagcgctgccaccacgtgtaaatagtatcggaccaacccagcgtct
tcctatacagttccaccctgtttactaaacccccgttttctaccgagtacgttaataataaaagcctgtt
tgagtctaactctggtttcttggtgtggtttggcaataagaaactggggtgacttgatagtctggggatc
tggttttggaccccctcgtgcctttacctccgccctctggccctcacagaggggtaatgtctttgggtaa
agccaagctatatcccataagcttcctcatggaaaacagctg

Addgene diagnostic digest

This gel depicts the NEB 1kb ladder and a digestion of the plasmid with the following enzymes: HindIII and BglII

We expected the following band sizes for this digest: 4.6kb and 3.8kb for HindIII and 8.5kb for BglII. We see the expected pattern.