Skip to main content
Addgene
Open Menu

Cmv d0 dPspCas13b-GGS-Sun
(Plasmid #119858)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119858 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 119858-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 119858-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    cmv d0
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dCas13b-GGS-Sun

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGTTAAATTGCTAACGCAGTCA
  • 3′ sequencing primer CAGCAGCCAACTCAGCTTCCTTTCGGGCTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cmv d0 dPspCas13b-GGS-Sun was a gift from Bryan Dickinson (Addgene plasmid # 119858 ; http://n2t.net/addgene:119858 ; RRID:Addgene_119858)

  • For your References section:

    Targeted m(6)A Reader Proteins To Study Epitranscriptomic Regulation of Single RNAs. Rauch S, He C, Dickinson BC. J Am Chem Soc. 2018 Sep 26;140(38):11974-11981. doi: 10.1021/jacs.8b05012. Epub 2018 Sep 18. 10.1021/jacs.8b05012 PubMed 30183280
Related items:
Commonly requested with: