Cmv d0 dPspCas13b-GGS-Sun
(Plasmid
#119858)
-
PurposeCmv d0 dPspCas13b-GGS-Sun no-fusion construct
-
Depositing Lab
-
Depositing OrganizationUniversity of Chicago
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 119858 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 119858-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 119858-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonecmv d0
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas13b-GGS-Sun
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGTTAAATTGCTAACGCAGTCA
- 3′ sequencing primer CAGCAGCCAACTCAGCTTCCTTTCGGGCTT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 119858-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 119858-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cmv d0 dPspCas13b-GGS-Sun was a gift from Bryan Dickinson (Addgene plasmid # 119858 ; http://n2t.net/addgene:119858 ; RRID:Addgene_119858) -
For your References section:
Targeted m(6)A Reader Proteins To Study Epitranscriptomic Regulation of Single RNAs. Rauch S, He C, Dickinson BC. J Am Chem Soc. 2018 Sep 26;140(38):11974-11981. doi: 10.1021/jacs.8b05012. Epub 2018 Sep 18. 10.1021/jacs.8b05012 PubMed 30183280