Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

hU6 promoter PspCas13b gRNA dual luciferase reporter 3’UTR
(Plasmid #119859)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 119859 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA dual luciferase reporter
  • gRNA/shRNA sequence
    TAGTTGTTTAAACGAGCTCGCTAGCCTCGAGTCTAGAGTCGACCTGCAGG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer taatacgactcactatagg
  • 3′ sequencing primer CTGTGGATAACCGTATTACCGCCTTTGAGTGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hU6 promoter PspCas13b gRNA dual luciferase reporter 3’UTR was a gift from Bryan Dickinson (Addgene plasmid # 119859 ; http://n2t.net/addgene:119859 ; RRID:Addgene_119859)
  • For your References section:

    Targeted m(6)A Reader Proteins To Study Epitranscriptomic Regulation of Single RNAs. Rauch S, He C, Dickinson BC. J Am Chem Soc. 2018 Sep 26;140(38):11974-11981. doi: 10.1021/jacs.8b05012. Epub 2018 Sep 18. 10.1021/jacs.8b05012 PubMed 30183280