Cmv d0 dPspCas13b-GGS-NYTHDF2(100-200)
(Plasmid
#119856)
-
PurposeCmv d0 dPspCas13b-GGS-NYTHDF2(100-200) (YTDHF2 100-200 subdomain)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119856 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonecmv d0
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas13b-GGS-NYTHDF2(100-200)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGTTAAATTGCTAACGCAGTCA
- 3′ sequencing primer CAGCAGCCAACTCAGCTTCCTTTCGGGCTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cmv d0 dPspCas13b-GGS-NYTHDF2(100-200) was a gift from Bryan Dickinson (Addgene plasmid # 119856 ; http://n2t.net/addgene:119856 ; RRID:Addgene_119856) -
For your References section:
Targeted m(6)A Reader Proteins To Study Epitranscriptomic Regulation of Single RNAs. Rauch S, He C, Dickinson BC. J Am Chem Soc. 2018 Sep 26;140(38):11974-11981. doi: 10.1021/jacs.8b05012. Epub 2018 Sep 18. 10.1021/jacs.8b05012 PubMed 30183280