pGEX-6p1-GST-ArcΔCTD
(Plasmid #119878)

• Purpose: Bacterial Expression construct for the production and purification of Arc missing C-terminal Domain
• Depositing Lab: Jason Shepherd
• Publication: Pastuzyn et al Cell. 2018 Mar 22;173(1):275. doi: 10.1016/j.cell.2018.03.024.

Backbone

• Vector backbone: pGEX-6p1
• Backbone size w/o insert (bp): 4927
• Total vector size (bp): 5878
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: use BL21 for protein production
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Activity Regulated Cytoskeletal Protein
• Alt name: Arc, Arg3.1
• Species: R. norvegicus (rat)
• Insert Size (bp): 951
• Mutation: Deletion of nt 832-1110
• GenBank ID: Z46925.1
• Entrez Gene: Arc (a.k.a. rg3.1)
• Promoter: tac
• Tag / Fusion Protein:
  • GST (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: TTTGCAGGGCTGGCAAGCCAC

Resource Information

• Supplemental Documents:
  • pGEX-6p1-Arc_ΔCTD.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry