Skip to main content

pMaCTag-P08
(Plasmid #120019)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120019 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 120019-D50 50 μg of DNA in Tris buffer $495
DNA 120019-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pFA6a
  • Backbone size w/o insert (bp) 2412
  • Vector type
    PCR Template
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mClover3
  • Species
    H. sapiens (human)
  • Promoter None
  • Tag / Fusion Protein
    • mClover3 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer SP6
  • 3′ sequencing primer AAACCACAACTAGAATGCAGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Template plasmid for C-terminal PCR tagging of mammalian genes. For M1 and M2 tagging oligo design please visit www.pcr-tagging.com Please visit https://www.biorxiv.org/content/early/2018/11/20/473876 for BioRxiv preprint

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMaCTag-P08 was a gift from Michael Knop (Addgene plasmid # 120019 ; http://n2t.net/addgene:120019 ; RRID:Addgene_120019)
  • For your References section:

    CRISPR-Cas12a-assisted PCR tagging of mammalian genes. Fueller J, Herbst K, Meurer M, Gubicza K, Kurtulmus B, Knopf JD, Kirrmaier D, Buchmuller BC, Pereira G, Lemberg MK, Knop M. J Cell Biol. 2020 Jun 1;219(6). pii: 151766. doi: 10.1083/jcb.201910210. 10.1083/jcb.201910210 PubMed 32406907