pMaCTag-Z14
(Plasmid
#120057)
-
PurposeTemplate for C-terminal PCR tagging of mammalian genes (Zeocin selection) with mNeptune2.5
-
Depositing Lab
-
Depositing OrganizationUniversitaet Heidelberg
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 120057 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 120057-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 120057-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepFA6a
- Backbone size w/o insert (bp) 2412
-
Vector typePCR Template
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemNeptune2.5
-
SpeciesH. sapiens (human)
- Promoter None
-
Tag
/ Fusion Protein
- mNeptune2.5 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer SP6
- 3′ sequencing primer AAACCACAACTAGAATGCAGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Template plasmid for C-terminal PCR tagging of mammalian genes. For M1 and M2 tagging oligo design please visit www.pcr-tagging.com Please visit https://www.biorxiv.org/content/early/2018/11/20/473876 for BioRxiv preprint
DNA (Catalog # 120057-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 120057-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMaCTag-Z14 was a gift from Michael Knop (Addgene plasmid # 120057 ; http://n2t.net/addgene:120057 ; RRID:Addgene_120057) -
For your References section:
CRISPR-Cas12a-assisted PCR tagging of mammalian genes. Fueller J, Herbst K, Meurer M, Gubicza K, Kurtulmus B, Knopf JD, Kirrmaier D, Buchmuller BC, Pereira G, Lemberg MK, Knop M. J Cell Biol. 2020 Jun 1;219(6). pii: 151766. doi: 10.1083/jcb.201910210. 10.1083/jcb.201910210 PubMed 32406907