pDYSCKO-ADE1
(Plasmid
#120264)
-
PurposepDYSCKO canavanine co-selection vector with a guide targeting the ADE1 locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 120264 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepDYSCKO
- Backbone size w/o insert (bp) 6467
- Total vector size (bp) 6468
-
Modifications to backboneStuffer replaced with guide targeting ADE1 (gRNA = GTCAATTACGAAGACTGAAC)
-
Vector typeCRISPR, Synthetic Biology
-
Selectable markersURA3 ; Canavanine (after mutagenesis)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepDYSCKO cassette-ADE1 targeting guide
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1038
- Promoter SNR52
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GCGCCGCTACAGGGCGCGT
- 3′ sequencing primer gctcgaaggctttaatttgc (preferable for Sanger)
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
See Double Selection Enhances the Efficiency of Target-AID and Cas9-Based Genome Editing in Yeast. (PMID: 30097473) for detailed protocols for gRNA cloning and mutagenesis protocol.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDYSCKO-ADE1 was a gift from Christian Landry (Addgene plasmid # 120264 ; http://n2t.net/addgene:120264 ; RRID:Addgene_120264) -
For your References section:
Double Selection Enhances the Efficiency of Target-AID and Cas9-Based Genome Editing in Yeast. Despres PC, Dube AK, Nielly-Thibault L, Yachie N, Landry CR. G3 (Bethesda). 2018 Oct 3;8(10):3163-3171. doi: 10.1534/g3.118.200461. 10.1534/g3.118.200461 PubMed 30097473