p3x-Flag Gli3 30R3-1
(Plasmid
#120304)
-
PurposeExpresses human protein Gli containing a 4HT-inducible intein evolved to operate at 30C
-
Depositing Lab
-
Depositing OrganizationHarvard University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 120304 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 120304-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 120304-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepFLAG-CMV-5.1
-
Backbone manufacturerSigma
- Backbone size w/o insert (bp) 6200
- Total vector size (bp) 9732
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name30R3-1, Gli3
-
SpeciesSynthetic
-
Insert Size (bp)1239
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xFLAG (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GGCGGGACTATGGTTGCTGACTAAT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 120304-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 120304-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p3x-Flag Gli3 30R3-1 was a gift from David Liu (Addgene plasmid # 120304 ; http://n2t.net/addgene:120304 ; RRID:Addgene_120304) -
For your References section:
Directed evolution of a small-molecule-triggered intein with improved splicing properties in mammalian cells. Peck SH, Chen I, Liu DR. Chem Biol. 2011 May 27;18(5):619-30. doi: 10.1016/j.chembiol.2011.02.014. 10.1016/j.chembiol.2011.02.014 PubMed 21609843