C74m
(Plasmid
#120986)
-
PurposeMoClo golden gate assembly CD part for LuxRQ-FMY (Adam Meyer's improved LuxR activator from https://doi.org/10.1101/285866, selected for dynamic range and low cross-sensitivity).
-
Depositing Lab
-
Depositing OrganizationCalifornia Institute of Technology
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 120986 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneDVA
- Backbone size w/o insert (bp) 2100
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLuxR Adam Meyer
-
SpeciesSynthetic
-
Insert Size (bp)758
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AAATAGGCGTATCACGAGGCA
- 3′ sequencing primer TTACCGCCTTTGAGTGAGCTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please see Supplemental Documents for annotated Genbank file.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
C74m was a gift from Richard Murray (Addgene plasmid # 120986 ; http://n2t.net/addgene:120986 ; RRID:Addgene_120986)