pX330-TP53-2
(Plasmid
#121918)
-
PurposeEncodes sgRNA targeting exon 9 of TP53
-
Depositing Lab
-
Depositing OrganizationDana-Farber Cancer Institute
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 121918 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 121918-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 121918-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepX330 (Addgene #42230)
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 8500
- Total vector size (bp) 8487
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTP53
-
Alt namep53
-
gRNA/shRNA sequenceGGAGAGGAGCTGGTGTTGT
-
SpeciesH. sapiens (human)
-
Entrez GeneTP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gactatcatatgcttaccgt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The sgRNA targeting TP53 was cloned into pX330 (Addgene #42230) using a Golden Gate Assembly reaction.
DNA (Catalog # 121918-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 121918-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-TP53-2 was a gift from William Hahn (Addgene plasmid # 121918 ; http://n2t.net/addgene:121918 ; RRID:Addgene_121918) -
For your References section:
MDM2 and MDM4 are Therapeutic Vulnerabilities in Malignant Rhabdoid Tumors. Howard TP, Arnoff TE, Song MR, Giacomelli AO, Wang X, Hong AL, Dharia NV, Wang S, Vazquez F, Pham MT, Morgan AM, Wachter F, Bird GH, Kugener G, Oberlick EM, Rees MG, Tiv HL, Hwang JH, Walsh KH, Cook A, Krill-Burger JM, Tsherniak A, Gokhale PC, Park PJ, Stegmaier K, Walensky LD, Hahn WC, Roberts CWM. Cancer Res. 2019 Feb 12. pii: 0008-5472.CAN-18-3066. doi: 10.1158/0008-5472.CAN-18-3066. 10.1158/0008-5472.CAN-18-3066 PubMed 30755442