-
Depositing Lab
-
Depositing OrganizationInstitute for Cancer Research d/b/a the Research Institute of Fox Chase Cancer Center
Located in the United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 12210 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 12210-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 12210-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV6
- Backbone size w/o insert (bp) 4900
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePak1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2000
-
MutationCatalytically inactive Pak1: K299R
-
Entrez GenePAK1 (a.k.a. IDDMSSD, PAKalpha, alpha-PAK, p65-PAK)
-
Tag
/ Fusion Protein
- Myc (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CTCGTTTAGTGAACCGTCAG
- 3′ sequencing primer GGAACTTCCAAGGCCAGGA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the reference sequence from the depositor does not have the K299R mutation. Addgene has sequenced this plasmid and verified this mutation.
There is also an additional mutation in this plasmid - L516I. The L516I mutation, or SNP, has been present from the very beginning (~1995). The crystal structure of Pak1 uses this clone, so it is present there too. The depositor does not think it affects function in any way.
Pak1 may contain a G401S mutation. Depositor states that this mutation should not affect plasmid function.
DNA (Catalog # 12210-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 12210-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV6M-Pak1 K299R was a gift from Jonathan Chernoff (Addgene plasmid # 12210 ; http://n2t.net/addgene:12210 ; RRID:Addgene_12210) -
For your References section:
Human p21-activated kinase (Pak1) regulates actin organization in mammalian cells. Sells MA, Knaus UG, Bagrodia S, Ambrose DM, Bokoch GM, Chernoff J. Curr Biol. 1997 Mar 1. 7(3):202-10. 10.1016/S0960-9822(97)70091-5 PubMed 9395435