Skip to main content

pAAV hSyn syph-GFP-myc-BoNT/B(1-146)-iLID
(Plasmid #122981)

Ordering

This material is available to academics and nonprofits only. Currently unavailable outside the U.S.
Item Catalog # Description Quantity Price (USD)
Plasmid 122981 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pAAV hSyn
  • Backbone size w/o insert (bp) 4500
  • Total vector size (bp) 7200
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Syph-GFP-myc-BoNT/B(1-146)-iLID
  • Species
    R. norvegicus (rat), Synthetic
  • Insert Size (bp)
    2700
  • Entrez Gene
    Syp (a.k.a. Syp1)
  • Promoter human synapsin
  • Tag / Fusion Protein
    • GFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer actcagcgctgcctcagt
  • 3′ sequencing primer ccacatagcgtaaaaggagcaac
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    iLID was obtained from Dr. Brian Kuhlman, University of North Carolina Chapel Hill BoNT/B was a gift from Dr. Thomas Binz, Hannover Medical School

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV hSyn syph-GFP-myc-BoNT/B(1-146)-iLID was a gift from Matthew Kennedy (Addgene plasmid # 122981 ; http://n2t.net/addgene:122981 ; RRID:Addgene_122981)
  • For your References section:

    A Photoactivatable Botulinum Neurotoxin for Inducible Control of Neurotransmission. Liu Q, Sinnen BL, Boxer EE, Schneider MW, Grybko MJ, Buchta WC, Gibson ES, Wysoczynski CL, Ford CP, Gottschalk A, Aoto J, Tucker CL, Kennedy MJ. Neuron. 2019 Jan 15. pii: S0896-6273(19)30003-0. doi: 10.1016/j.neuron.2019.01.002. 10.1016/j.neuron.2019.01.002 PubMed 30704911