Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV hSyn mCh-IRES-SspB(milli)-BoNT/B(147-441, Y365A)
(Plasmid #122985)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 122985 Standard format: Plasmid sent in bacteria as agar stab 1 $75

Currently unavailable outside the U.S.

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV hSyn
  • Backbone size w/o insert (bp) 4500
  • Total vector size (bp) 7200
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCh-IRES-SspB(milli)-BoNT/B(147-441)
  • Insert Size (bp)
    2600
  • Mutation
    SspB contains A58V,R73Q "milli" mutations, BoNT/B contains Y365A mutation
  • Promoter human synapsin
  • Tag / Fusion Protein
    • mCh

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer actcagcgctgcctcagt
  • 3′ sequencing primer ccacatagcgtaaaaggagcaac
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    SspB was obtained from Dr. Brian Kuhlman's lab (University of North Carolina, Chapel Hill) BoNT/B was a gift from Dr Thomas Binz (Hannover Medical School)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV hSyn mCh-IRES-SspB(milli)-BoNT/B(147-441, Y365A) was a gift from Matthew Kennedy (Addgene plasmid # 122985 ; http://n2t.net/addgene:122985 ; RRID:Addgene_122985)
  • For your References section:

    A Photoactivatable Botulinum Neurotoxin for Inducible Control of Neurotransmission. Liu Q, Sinnen BL, Boxer EE, Schneider MW, Grybko MJ, Buchta WC, Gibson ES, Wysoczynski CL, Ford CP, Gottschalk A, Aoto J, Tucker CL, Kennedy MJ. Neuron. 2019 Jan 15. pii: S0896-6273(19)30003-0. doi: 10.1016/j.neuron.2019.01.002. 10.1016/j.neuron.2019.01.002 PubMed 30704911