Skip to main content

pAAV-EF1a-DIO-FLPo-Myc
(Plasmid #124641)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124641 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pAAV-Ef1a-DIO
  • Backbone manufacturer
    Karl Deisseroth (pAAV-Ef1a-DIO-hChR2(E123T/T159C)-mCherry, Addgene 35510)
  • Backbone size w/o insert (bp) 5603
  • Total vector size (bp) 6932
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FLPo
  • Alt name
    FLP
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1329
  • Promoter EF1a
  • Tag / Fusion Protein
    • myc tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CACCCACACAAAGGAAAAGGGCC
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1a-DIO-FLPo-Myc was a gift from David Dupret (Addgene plasmid # 124641 ; http://n2t.net/addgene:124641 ; RRID:Addgene_124641)
  • For your References section:

    A Hippocampus-Accumbens Tripartite Neuronal Motif Guides Appetitive Memory in Space. Trouche S, Koren V, Doig NM, Ellender TJ, El-Gaby M, Lopes-Dos-Santos V, Reeve HM, Perestenko PV, Garas FN, Magill PJ, Sharott A, Dupret D. Cell. 2019 Mar 7;176(6):1393-1406.e16. doi: 10.1016/j.cell.2018.12.037. Epub 2019 Feb 14. 10.1016/j.cell.2018.12.037 PubMed 30773318