Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-cFos-tTA-pA
(Plasmid #66794)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 66794 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC
  • Backbone size w/o insert (bp) 3600
  • Total vector size (bp) 6673
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cfos promoter linked to the tet activator gene
  • Species
    Synthetic
  • Insert Size (bp)
    1945
  • Tag / Fusion Protein
    • no

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer GACCATCTCCGAAATCCTACACG
  • 3′ sequencing primer ACAAAGGCATTAAAGCAGCGTATCCACAT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    cfos-tTA was taken from Addgene plasmid ID #: 34856
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-cFos-tTA-pA was a gift from William Wisden (Addgene plasmid # 66794 ; http://n2t.net/addgene:66794 ; RRID:Addgene_66794)
  • For your References section:

    Neuronal ensembles sufficient for recovery sleep and the sedative actions of alpha2 adrenergic agonists. Zhang Z, Ferretti V, Guntan I, Moro A, Steinberg EA, Ye Z, Zecharia AY, Yu X, Vyssotski AL, Brickley SG, Yustos R, Pillidge ZE, Harding EC, Wisden W, Franks NP. Nat Neurosci. 2015 Apr;18(4):553-61. doi: 10.1038/nn.3957. Epub 2015 Feb 23. 10.1038/nn.3957 PubMed 25706476